| Haplogroup J

|
| Time of origin |
30,000 years BP |
| Place of origin |
Near East |
| Ancestor |
IJ |
| Defining mutations |
M304 |
Haplogroup J Distribution
In human genetics, Haplogroup J (previously known as HG9 or Eu9/Eu10) is a Y-chromosome DNA haplogroup. It is defined by the 12f2.1 genetic marker, or the equivalent M304 marker.
Origins
Haplogroup J is believed to have arisen 31,700 years ago (plus or minus 12,800 years) in the Near East (Semino et al. 2004). It is most closely related to Haplogroup I, as both Haplogroup I and Haplogroup J are descendants of Haplogroup IJ (S2, S22). Along with haplogroups G, H and K, haplogroup IJ is in turn derived from Haplogroup F. The main current subgroups J1 and J2, which now account between them for almost all of the population of the haplogroup, are both believed to have arisen very early, at least 10,000 years ago.
Haplogroup J is found in greatest concentration in the Caucasus and Southwest Asia. Outside of these regions, haplogroup J has a moderate presence in Southern Europe (especially in central and southern Italy, Greece, and Albania), Central Asia, and South Asia, particularly in the form of its subclade J2-M172. Haplogroup J is also found in North Africa and the Horn of Africa, particularly in the form of its subclade J1-M267. Subclades J2a and J2a1b1 are found mostly in Greece, Anatolia, and southern Italy.
Subclades
The subclades of Haplogroup J with their defining mutation, according to the 2006 ISOGG tree:
- J (12f2.1, M304, S6, S34, S35)
- J*
- J1 (M267) Typical of populations of Dagestan, Mesopotamia, the Levant, Arabia, and Semitic-speaking populations of North Africa and Northeast Africa, with a moderate distribution throughout Southwest Asia
- J1*
- J1a (M62)
- J1b (M365)
- J1c (M367, M368)
- J1d (M369)
- J1e (M390)
- J2 (M172) Typical of populations of Southern Europe, Turkey, Iraq, Iran, and the Caucasus, with a moderate distribution throughout Southwest Asia, Central Asia, South Asia, and North Africa
- J2*
- J2a (M410)
- J2a*
- J2a1 (DYS413≤18)
- J2a1*
- J2a1a (M47, M322)
- J2a1b (M67 (S51))
- J2a1b*
- J2a1b1 (M92, M260)
- J2a1b2 (M163, M166)
- J2a1c (M68)
- J2a1d (M137)
- J2a1e (M158)
- J2a1f (M289)
- J2a1g (M318)
- J2a1h (M319)
- J2a1i (M339)
- J2a1j (M419)
- J2a1k (DYS445≤7)
- J2a2 (M340)
- J2b (M12, M314, M221)
- J2b*
- J2b1 (M102) Mainly found in the Balkans, Greece, and Italy (possibly from Ancient Greeks)
- J2b1*
- J2b1a (M241)
- J2b1a*
- J2b1a1 (M99)
- J2b1a2 (M280)
- J2b1a3 (M321)
- J2b1b (M205)
It is subdivided into two subclades: haplogroup J2, defined by the M172 marker, and haplogroup J1, defined by the M267 marker.
J1
-
Haplogroup J1 appears at high frequencies among populations of the Arabian Peninsula, Southern Levant, North Africa, and Dagestan. J1 was spread by two temporally distinct migratory episodes, the most recent one probably associated with the diffusion of Muslims from Arabia since the 6th century CE.[2]
Distribution
Haplogroup J1 is most frequent in the Arabian Peninsula (Yemen 85% [1] , Hadramawt - Yemen 72%, Qatar 58% (Cadenas et al. 2008)) and Dagestan (Dargins 91%, Avars 67%, Chamalins 67%, Lezgins 58%, Tabassarans 49%, Andis 37%, Bagvalins 21% (Yunusbaev et al. 2006)).
J1 is generally frequent amongst Arabs of the southern Levant, i.e. Palestinian Arabs (38.4%) (Semino et al.) and Arab Bedouins (62% and 82% in Negev desert Bedouins). It is also very common among other Arabic-speaking populations, such as those of Algeria (35%), Syria (30%), Iraq (33%), the Sinai Peninsula, and the Arabian Peninsula. The frequency of Haplogroup J1 collapses suddenly at the borders of Arabic countries with mainly non-Arabic countries, such as Turkey and Iran, yet it is found at low frequency among the populations of those countries, as well as in Cyprus, Sicily and the Iberian Peninsula. It entered Ethiopia with the spread of Semitic speakers (11% Eritrea & 9 % Ethiopia & Ethiopia-Amhara 33.3%). It spread later to North Africa in historic times (as identified by the motif YCAIIa22-YCAIIb22; Algerians 35.0%, Tunisians 30.1%), where it became something like a marker of the Arab expansion in the early medieval period (Semino et al. 2004). Researchers believe that marker DYS388=17 (Y DNA tests for STR - Short Tandem Repeater) is linked with the later expansion of Arabian tribes in the southern Levant and northern Africa (Di Giacomo et al. 2004).
Haplogroup J1 is found almost exclusively among modern populations of the Southwest Asia, North Africa, and the Horn of Africa, essentially delineating the region popularly known as the Middle East and associated with speakers of Semitic languages and Northeast Caucasian languages. The distribution of J1 outside of the Middle East may be associated with Arabs and Phoenicians who traded and conquered in Sicily, southern Italy, Spain, Azerbaijan, Turkey, and Pakistan, or with Jews, who have historical origins in the Middle East and speak (or historically spoke) a Semitic language, though typically Haplogroup J2 is more than twice as common among Jews. In Jewish populations overall, J1 constitutes 19.0% of the Ashkenazim results and 11.9% of the Sephardic results (Semino et al. 2004)(Behar et al. 2004). Haplogroup J1 with marker DYS388=13 is a distinctive type found in eastern Anatolia (Cinnioglu et al. 2004).
J2
-
Haplogroup J2 is thought to have originated in Anatolia (Turkey) or northern Mesopotamia and to have subsequently spread to other Middle Eastern areas, Europe, Central Asia, and South Asia. Subclades of Haplogroup J2 are commonly found in Turkey, the Levant, Mesopotamia, the South Caucasus (Georgia, Armenia, Azerbaijan), Iran, Central Asia, and South Asia: for example, Muslim Kurds (28.4%), Central Turks (27.9%), Georgians (26.7%), Iraqis (25.2%), Lebanese (25%), Saudi Arabians (18.9%), Ashkenazi Jews (23.2%), Sephardi Jews (28.6%), Iranians (23.3%), Tajiks (18.4%), and Pakistanis (14.7%). Haplogroup J2 is also common among Turkic peoples of the North Caucasus, such as Balkars (25%) and Kumyks (25%). J2 is not regularly found in Semitic-speaking populations of Africa, such as the Amhara and Tigrinya in Eritrea and Ethiopia (Semino et al. 2004). However, J2 has been found to encompass several subhaplogroups (22 subhaplogroups, including 5 that have high frequencies) that originated in or expanded into different regions: the Iberian Peninsula, Italy, the Balkans, the Aegean, Anatolia (Turkey and Kurds), the Caucasus (Georgia), and Somalia (Sanchez et al. 2005). Haplogroup J2 used to be considered a genetic marker of Anatolian Neolithic agriculturalists. It is also very frequent in the Balkans (Greeks 20.6%, Albanians 19.6%) and in Iberia (16.7-29.1%). Its frequency rapidly drops in the Carpathian basin (Ukrainians 7.3%, Croatians 6.2%, Romanians 5.6%[2], Hungarians 2.0%) and in Southeastern Iranian-speaking areas (Pashtuns 5.2%, Pamiris 6.1%). A significant presence of J2 (J2b2+J2a) was detected in western and south-western India (the highest being 21% among Dravidian middle castes, followed by upper castes, 18.6%, and lower castes 14%; Sengupta et al. 2006).
J*(xJ1,J2)
There are also some haplogroup J Y-chromosomes that belong to neither J1 nor J2, and are said to be in paragroup J*(xJ1,J2). This means that haplogroup J* includes all of J except for J1 and J2. However, Y-chromosomes that belong to paragroup J* are extremely rare among human populations of the present day.
Mutation
The technical details of M304 are:
- Nucleotide change: A to C
- Position (base pair): 421
- Total size (base pairs): 527
- Forward 5′→ 3′: caaagtgctgggattacagg
- Reverse 5′→ 3′: cttctagcttcatctgcattgt
Haplotypes
Modal
| DYS |
393 |
390 |
19 |
391 |
385A |
385B |
426 |
388 |
439 |
389I |
392 |
389II |
458 |
459A |
459B |
455 |
454 |
447 |
437 |
448 |
449 |
464A |
464B |
464C |
464D |
| Alleles |
12 |
23 |
14 |
10 |
14 |
17 |
11 |
16 |
11 |
13 |
11 |
30 |
17 |
8 |
9 |
11 |
11 |
26 |
14 |
20 |
28 |
13 |
14 |
15 |
16 |
- See also: Y-chromosomal Aaron
Famous
-
Matt Lauer belonged to Y-DNA haplogroup J.[3]
See also
References
- yJdb: the Y-haplogroup J database haplotypes of haplogroup J.
- [3]
- Haplogroup J subclades at International Society of Genetic Genealogy
- O. Semino et al. (2004), Origin, Diffusion, and Differentiation of Y-Chromosome Haplogroups E and J: Inferences on the Neolithization of Europe and Later Migratory Events in the Mediterranean Area American Journal of Human Genetics 74 1023-1034
- Nebel et al. 2001,see hModal Haplotypes of J1 (as Eu10)
- F. Di Giacomo et al. (2004), Y chromosomal haplogroup J as a signature of the post-neolithic colonization of Europe Human Genetics 115 357–371
- Sanchez et al. (2005), High frequencies of Y chromosome lineages characterized by E3b1, DYS19-11, DYS392-12 in Somali males, Eu J of Hum Genet 13, 856–866
- Sanghamitra Sengupta et al. (2006), Polarity and Temporality of High-Resolution Y-Chromosome Distributions in India Identify Both Indigenous and Exogenous Expansions and Reveal Minor Genetic Influence of Central Asian Pastoralists, American Journal of Human Genetics, 78 202-221
- Cinnioglu et al. (2004), Excavating Y-chromosome haplotype strata in Anatolia, Hum Genet (2004) 114 : 127–148, http://evolutsioon.ut.ee/publications/Cinnioglu2004.pdf
External links
|